SGN Marker C2_At3g54500

SGN-M8029
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300083 (SGN)
124301 (CGN)
---
Solanum tuberosumSingleSGN-U248785---
ArabidopsisSingleAt3g54500 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26464)
Chromosome
3
Position
20.19 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41495
Forward primer (5'-3')
TTGAAAAACTAAGAAGGCGACAGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCGGAACAAACTATCTCTGATACAAAGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g54500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8029 marker 8029
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)