SGN Marker C2_At3g54860

SGN-M8037
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312157 (SGN)
128263 (CGN)
---
Capsicum annuumSingleSGN-U203062---
Solanum tuberosumSingleSGN-U246915---
ArabidopsisSingleAt3g54860 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46701)
Chromosome
5
Position
39.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41447)
Chromosome
5
Position
112.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43423
Forward primer (5'-3')
ATCGCTGCACTCATTAAACGGGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTGATGGAAGGCGTTCTTTGGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38570)
Chromosome
5
Position
112.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41498
Forward primer (5'-3')
TGTTGATGGAAGGCGTTCTTTGGT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTAGTTGCTACAATTATGTCATATGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26473)
Chromosome
3
Position
20.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g54860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8037 marker 8037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)