SGN Marker C2_At3g55360

SGN-M8047
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301926 (SGN)
119801 (CGN)
---
Lycopersicon CombinedSingleSGN-U216472---
Solanum tuberosumSingleSGN-U245387---
ArabidopsisSingleAt3g55360 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46703)
Chromosome
5
Position
33.40 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41448)
Chromosome
5
Position
99.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43424
Forward primer (5'-3')
TGTTAGTGATCTCCAGATGAAGATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GTCTTCCTTCCTTTCCATCAAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38574)
Chromosome
5
Position
107.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39770
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26483)
Chromosome
3
Position
20.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11254
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 11255
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11256
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13332
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13333
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13334
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13335
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13336
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13337
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32637
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 33064
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 33065
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33066
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33067
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11257
Forward primer (5'-3')
TTTAGTGGTTACACGTAGCGGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCTCCTGCAGATCAGCAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g55360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8047 marker 8047
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)