SGN Marker C2_At3g58490

SGN-M8084
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307687 (SGN)
127299 (CGN)
---
Lycopersicon CombinedSingleSGN-U235378---
Solanum tuberosumSingleSGN-U250003---
ArabidopsisSingleAt3g58490 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38584)
Chromosome
3
Position
72.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39779
Forward primer (5'-3')
AGAATAACAGCAACTGAAGATGAGAAAG
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1000
Approximate temperature
60°C
Reverse primer (5'-3')
ATGATGTCAATCAAGCTGTGCATTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26521)
Chromosome
3
Position
21.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g58490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8084 marker 8084
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)