SGN Marker C2_At3g58730

SGN-M8086
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300793 (SGN)
119651 (CGN)
---
Capsicum annuumMultipleSGN-U198396---
Lycopersicon CombinedSingleSGN-U214673---
Solanum tuberosumSingleSGN-U244441---
ArabidopsisSingleAt3g58730 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38585)
Chromosome
1
Position
46.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39780
Forward primer (5'-3')
CCTCATTTGCTCTGACAGAGGCCAAAGAT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26523)
Chromosome
3
Position
21.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11285
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCAAACTTGGGGAGCTTCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
53°C
  
PCR data   Exp. ID 11286
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCAAACTTGGGGAGCTTCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
53°C
  
PCR data   Exp. ID 11287
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCAAACTTGGGGAGCTTCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
53°C
  
PCR data   Exp. ID 12297
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12298
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12299
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12300
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12301
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12302
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12303
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12304
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12305
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12306
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12307
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12308
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33352
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33353
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33354
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33355
Forward primer (5'-3')
TTGGAGTTATTAAAGCTCGCCTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTGTGTTCTCCAACCGAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g58730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8086 marker 8086
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)