SGN Marker C2_At3g60300

SGN-M8098
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310520 (SGN)
129693 (CGN)
---
Lycopersicon CombinedSingleSGN-U219023---
Solanum tuberosumSingleSGN-U249032---
ArabidopsisSingleAt3g60300 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38588)
Chromosome
1
Position
50.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39782
Forward primer (5'-3')
TGGAGCGGCTTTCGAGTATGAATC
Accessions and product sizes
Solanum pennellii TA56
2500
Solanum lycopersicum TA209
2500
Approximate temperature
58°C
Reverse primer (5'-3')
AGCATGCTGAGTCTTCACAAAGTCAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26535)
Chromosome
3
Position
22.30 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g60300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8098 marker 8098
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)