SGN Marker CD2

SGN-M81

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1250
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGCTGCAGGGGGGGGGGGGGNAACATAAGTTACATGAAGAGAATAATTTACATGCATTGGTTTTGTATACTTTCAGTAATAATAATTGAA
TTAAATTCTTGATGGAATAAGTGGAGTTGAATTTTGCAGAAAAGCACTAGCAGCTGCAACTCCACTACCAAACTTCACTGGATAACCAAT
ATCCTTAAGTACCATTTCAACTCCAGCAAGACATCCCAATAGTTGCAACTCATTCAAGTTTCCAAGATGTCCTATTCTGAAAACTTTTCC
TGCAACTTTGTTTAGGCCGAGACCTAAGCTTAAGTTGTATCGCTTCCATGCCCTTTTCACGATTTCAGAACTTTCAATGTGTGGAGGAAC
AACAACGGCTGTGACTGTATCACTGAACCATTCCTCCTTCTGAGTGCAGTTCTTCAAGCCCCATGCCTCCACAGCAAGTCTTGTTGCTTT
GCCAAGGCGAGCGTGTCTTGCAATCACATTATCAAGGCCTTCCTCAAAAAGAAGGTCAAGAGCTGCTCTCAGACCATACAAAAGTTGGAT
GGAAGGAGTATACGGCCAATAAG
Reverse sequence
GGGGGGGGAAACATAAGTTACATGAAGAGAATAATTTACATGCATTGGTTTTGTATACTTTCAGTAATAATAATTGAATTAAATTCTTGA
TGGAATAAGTGGAGTTGAATTTTGCAGAAAAGCACTAGCAGCTGCAACTCCACTACCAAACTTCACTGGATAACCAATATCCTTAAGTAC
CATTTCAACTCCAGCAAGACATCCCAATAGTTGCAACTCATTCAAGTTTCCAAGATGTCCTATTCTGAAAACTTTTCCTGCAACTTTGTT
TAGGCCGAGACCTAAGCTTAAGTTGTATCGCTTCCATGCCCTTTTCACGATTTCAGAACTTTCAATGTGTGGAGGAACAACAACGGCTGT
GACTGTATCACTGAACCATTCCTCCTTCTGAGTGCAGTTCTTCAAGCCCCATGCCTCCACAGCAAGTCTTGTTGCTTTGCCAAGGCGAGC
GTGTCTTGCAATCACATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1606746.2e-41104 (18.5% of RFLP seq)+
SGN-U1436432e-115209 (37.1% of RFLP seq)+
SGN-U143642542 (96.3% of RFLP seq)+
SGN-U1606741.3e-41105 (22.4% of RFLP seq)-
SGN-U1436433e-116210 (44.9% of RFLP seq)-
SGN-U143642460 (98.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53432)
Chromosome
12
Position
77.99 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51697)
Chromosome
12
Position
46.31 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42941)
Chromosome
12
Position
100.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43941
Forward primer (5'-3')
GCAAGACACGCTCGCCT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTGATGGAATAAGTGGAGTTGAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38931)
Chromosome
12
Position
120.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7997)
Chromosome
12
Position
93.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7996)
Chromosome
12
Position
60.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD2 was used as an overgo probe on plate 3 [well A10]

Plausible BAC Matches:   P116D04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACGGCTGTGACTGTATCACTGAAC
B sequence
CTCAGAAGGAGGAATGGTTCAGTG
AB sequence
ACGGCTGTGACTGTATCACTGAACCATTCC
Marker sequence
ACATAAGTTACATGAAGAGAATAATTTACATGCATTGGTTTTGTATACTT
TCAGTAATAATAATTGAATTAAATTCTTGATGGAATAAGTGGAGTTGAAT
TTTGCAGAAAAGCACTAGCAGCTGCAACTCCACTACCAAACTTCACTGGA
TAACCAATATCCTTAAGTACCATTTCAACTCCAGCAAGACATCCCAATAG
TTGCAACTCATTCAAGTTTCCAAGATGTCCTATTCTGAAAACTTTTCCTG
CAACTTTGTTTAGGCCGAGACCTAAGCTTAAGTTGTATCGCTTCCATGCC
CTTTTCACGATTTCAGAACTTTCAATGTGTGGAGGAACAACAACGGCTGT
GACTGTATCACTGAACCATTCCTCCTTCTGAGTGCAGTTCTTCAAGCCCC
ATGCCTCCACAGCAAGTCTTGTTGCTTTGCCAAGGCGAGCGTGTCTTGCA
ATCACATTATCAAGGCCTTCCTCAAAAAGAAGGTCAAGAGCTGCTCTCAG
ACCATACAAAAGTTGGATGGAAGGAGTATACGGCCAATAAG
Genomic location of CD2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D81 marker 81
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)