SGN Marker C2_At3g63200

SGN-M8128
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310506 (SGN)
129944 (CGN)
---
Lycopersicon CombinedSingleSGN-U231732---
ArabidopsisSingleAt3g63200 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49263)
Chromosome
9
Position
58.90 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47199)
Chromosome
9
Position
53.64 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46707)
Chromosome
1
Position
110.70 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46501)
Chromosome
6
Position
97.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38597)
Chromosome
9
Position
52.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39789
Forward primer (5'-3')
AAGTATGCCGTGCCACGTCAGC
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1000
Approximate temperature
55°C
Reverse primer (5'-3')
TCAACTCCTGGTCCCACTCCTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
950
Solanum pennellii TA56
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26565)
Chromosome
3
Position
23.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g63200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8128 marker 8128
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)