SGN Marker C2_At3g63530

SGN-M8134
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304497 (SGN)
123183 (CGN)
---
Capsicum annuumSingleSGN-U197186---
ArabidopsisSingleAt3g63530 on TAIR---
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47200)
Chromosome
3
Position
54.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41456)
Chromosome
3
Position
67.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43432
Forward primer (5'-3')
CTTGTGTTAGCATTTAGAAAAACTGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACATGTGTGCACAAGGTAAAGTGGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38600)
Chromosome
3
Position
65.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41524
Forward primer (5'-3')
GAATTGCAGTCTTTAGGGGAAGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AACATGTGTGCACAAGGTAAAGTGGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26571)
Chromosome
3
Position
23.47 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g63530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8134 marker 8134
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)