SGN Marker C2_At4g00740

SGN-M8141
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301932 (SGN)
123937 (CGN)
---
Capsicum annuumSingleSGN-U198930---
Lycopersicon CombinedSingleSGN-U219499---
Solanum tuberosumMultipleSGN-U250815---
ArabidopsisSingleAt4g00740 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46709)
Chromosome
1
Position
48.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42234)
Chromosome
1
Position
91.70 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43800
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCTGGCCATTTTGGAATTTTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41458)
Chromosome
1
Position
92.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43434
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTCGCTGGCCATTTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38603)
Chromosome
1
Position
62.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39794
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTCGCTGGCCATTTTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
225+450
Solanum pennellii TA56
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26578)
Chromosome
4
Position
0.31 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11325
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCGCTGGCCATTTTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11326
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCGCTGGCCATTTTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11327
Forward primer (5'-3')
TTGGGCTTGAGCTGTGTGATGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCGCTGGCCATTTTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g00740F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g00740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8141 marker 8141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)