Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g01560

SGN-M8150
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple307552 (SGN)
125926 (CGN)
---
Capsicum annuumSingleSGN-U197028---
Lycopersicon CombinedSingleSGN-U217740---
Solanum tuberosumSingleSGN-U247085---
ArabidopsisSingleAt4g01560 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49265)
Chromosome
11
Position
49.09 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47202)
Chromosome
11
Position
78.04 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38605)
Chromosome
11
Position
61.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39796
Forward primer (5'-3')
AGACTGTCTGTTTACCTGATGATGAAGAG
Accessions and product sizes
Solanum lycopersicum TA209
3000
Approximate temperature
Unknown
Reverse primer (5'-3')
TCATCAACATCGTTGCCAGCAAATAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26587)
Chromosome
4
Position
0.68 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11334
Forward primer (5'-3')
AGACTGTCTGTTTACCTGATGATGAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCAACATCGTTGCCAGCAAATAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11335
Forward primer (5'-3')
AGACTGTCTGTTTACCTGATGATGAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCAACATCGTTGCCAGCAAATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11336
Forward primer (5'-3')
AGACTGTCTGTTTACCTGATGATGAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCAACATCGTTGCCAGCAAATAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11337
Forward primer (5'-3')
AGACTGTCTGTTTACCTGATGATGAAGAG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 120
Solanum pennellii LA716: 180
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCAACATCGTTGCCAGCAAATAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g01560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8150 marker 8150
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)