SGN Marker C2_At4g01880

SGN-M8155
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308158 (SGN)
131518 (CGN)
---
Lycopersicon CombinedSingleSGN-U230585---
Solanum tuberosumSingleSGN-U256318---
ArabidopsisSingleAt4g01880 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41459)
Chromosome
1
Position
136.10 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43435
Forward primer (5'-3')
ATCTTTGTCTCTTCAGCCTTTTTACCAG
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38606)
Chromosome
1
Position
41.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39797
Forward primer (5'-3')
ATGCCCATTTTTCAAACAAGCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26592)
Chromosome
4
Position
0.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32419
Forward primer (5'-3')
ATGCCCATTTTTCAAACAAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32420
Forward primer (5'-3')
ATGCCCATTTTTCAAACAAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32421
Forward primer (5'-3')
ATGCCCATTTTTCAAACAAGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32422
Forward primer (5'-3')
ATGCCCATTTTTCAAACAAGCTC
Digested band sizes (using BslI)
Solanum pennellii LA716: 425
Solanum lycopersicum LA925: 325
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTAGAATTGAGGCCTGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g01880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8155 marker 8155
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)