Sol Genomics Network

SGN Marker C2_At4g01940

SGN-M8158
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	310935 (SGN) 131026 (CGN)	-	-	-
Lycopersicon Combined	Single	SGN-U220058	-	-	-
Solanum tuberosum	Single	SGN-U248359	-	-	-
Arabidopsis	Single	At4g01940 on TAIR	-	-	-

Mapped locations

Map: Tomato-EXPEN 2000
Map version 52 (location: 38608)
Chromosome 1
Position 47.80 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39799

Forward primer (5'-3')

AGAAAAGTTTGGAGAAGCCATCAAGG

Accessions and product sizes

Solanum pennellii TA56

400

Solanum lycopersicum TA209

400

Approximate temperature

55°C

Reverse primer (5'-3')

TGCTGCTTTGACTCCTGATCCAATAG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26595)
Chromosome 4
Position 0.84 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32427
Forward primer (5'-3') AGAAAAGTTTGGAGAAGCCATCAAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGCTGCTTTGACTCCTGATCCAATAG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 300	Approximate temperature 55°C

PCR data Exp. ID 32428
Forward primer (5'-3') AGAAAAGTTTGGAGAAGCCATCAAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGCTGCTTTGACTCCTGATCCAATAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 300	Approximate temperature 55°C

PCR data Exp. ID 32429
Forward primer (5'-3') AGAAAAGTTTGGAGAAGCCATCAAGG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGCTGCTTTGACTCCTGATCCAATAG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 300	Approximate temperature 55°C

PCR data Exp. ID 32430
Forward primer (5'-3') AGAAAAGTTTGGAGAAGCCATCAAGG	Digested band sizes (using DpnII) Solanum pennellii LA716: 300+200 Solanum lycopersicum LA925: 275	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGCTGCTTTGACTCCTGATCCAATAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 300 Solanum pennellii LA716: 300	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g01940

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8158 marker 8158

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer