SGN Marker C2_At4g01940

SGN-M8158
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310935 (SGN)
131026 (CGN)
---
Lycopersicon CombinedSingleSGN-U220058---
Solanum tuberosumSingleSGN-U248359---
ArabidopsisSingleAt4g01940 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38608)
Chromosome
1
Position
47.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39799
Forward primer (5'-3')
AGAAAAGTTTGGAGAAGCCATCAAGG
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTGCTTTGACTCCTGATCCAATAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26595)
Chromosome
4
Position
0.84 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32427
Forward primer (5'-3')
AGAAAAGTTTGGAGAAGCCATCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGCTTTGACTCCTGATCCAATAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32428
Forward primer (5'-3')
AGAAAAGTTTGGAGAAGCCATCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGCTTTGACTCCTGATCCAATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32429
Forward primer (5'-3')
AGAAAAGTTTGGAGAAGCCATCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGCTTTGACTCCTGATCCAATAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32430
Forward primer (5'-3')
AGAAAAGTTTGGAGAAGCCATCAAGG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 275
Solanum pennellii LA716: 200+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGCTTTGACTCCTGATCCAATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g01940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8158 marker 8158
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)