SGN Marker C2_At4g03200

SGN-M8181
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309486 (SGN)
126365 (CGN)
---
Lycopersicon CombinedSingleSGN-U239942---
ArabidopsisSingleAt4g03200 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49267)
Chromosome
9
Position
61.98 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47204)
Chromosome
9
Position
58.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46711)
Chromosome
1
Position
74.20 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41461)
Chromosome
3
Position
50.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43437
Forward primer (5'-3')
TGGGGCTGAGCCTTCAGGGAA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCCAGCATATCTGCTGCACAGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38614)
Chromosome
9
Position
58.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39803
Forward primer (5'-3')
AGAAAGCAACATAGGTTATTAGGAAAC
Accessions and product sizes
Solanum pennellii TA56
Multiple
Approximate temperature
50°C
Reverse primer (5'-3')
TCACAGAAACGGAATTCCCTGAAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26618)
Chromosome
4
Position
1.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32435
Forward primer (5'-3')
AGAAAGCAACATAGGTTATTAGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACAGAAACGGAATTCCCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32436
Forward primer (5'-3')
AGAAAGCAACATAGGTTATTAGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACAGAAACGGAATTCCCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32437
Forward primer (5'-3')
AGAAAGCAACATAGGTTATTAGGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACAGAAACGGAATTCCCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32438
Forward primer (5'-3')
AGAAAGCAACATAGGTTATTAGGAAAC
Digested band sizes (using MspI)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACAGAAACGGAATTCCCTGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g03200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8181 marker 8181
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)