SGN Marker C2_At4g04930

SGN-M8186
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309835 (SGN)
125908 (CGN)
---
Lycopersicon CombinedSingleSGN-U218192---
Solanum tuberosumSingleSGN-U257303---
ArabidopsisSingleAt4g04930 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46502)
Chromosome
9
Position
61.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38618)
Chromosome
10
Position
23.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39806
Forward primer (5'-3')
TACAGATGAACCTCATGCTTCTCGTAG
Accessions and product sizes
Solanum lycopersicum TA209
880
Solanum pennellii TA56
1000
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCCATCAACTCCTTGGAAGCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
880
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26624)
Chromosome
4
Position
2.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11355
Forward primer (5'-3')
TACAGATGAACCTCATGCTTCTCGTAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCATCAACTCCTTGGAAGCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11356
Forward primer (5'-3')
TACAGATGAACCTCATGCTTCTCGTAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCATCAACTCCTTGGAAGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11357
Forward primer (5'-3')
TACAGATGAACCTCATGCTTCTCGTAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCATCAACTCCTTGGAAGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32439
Forward primer (5'-3')
TACAGATGAACCTCATGCTTCTCGTAG
Digested band sizes (using AluI)
Solanum pennellii LA716: 250+450+500
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCATCAACTCCTTGGAAGCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,BslI,BspEI,EcoRI,PmlI,Sau96I,StuI,TspRI
All possible enzymes for lycopersicum and pimpinellifolium: AseI,BanI,BstNI,EcoRI,PmlI,ScrFI
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g04930F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g04930F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g04930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8186 marker 8186
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)