SGN Marker C2_At4g08230

SGN-M8193
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309695 (SGN)
125956 (CGN)
---
Lycopersicon CombinedSingleSGN-U216209---
Solanum tuberosumSingleSGN-U248870---
ArabidopsisSingleAt4g08230 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49269)
Chromosome
11
Position
5.95 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47207)
Chromosome
11
Position
61.86 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38621)
Chromosome
11
Position
41.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39808
Forward primer (5'-3')
ATTTCTTTTGGTCCATCATCAACTTC
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1500
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAAGAACCACAGGCAGGAAGAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
700+725
Solanum lycopersicum TA209
300+1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26631)
Chromosome
4
Position
5.19 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g08230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8193 marker 8193
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)