SGN Marker C2_At4g10360

SGN-M8212
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310865 (SGN)
125352 (CGN)
---
Capsicum annuumSingleSGN-U198682---
ArabidopsisSingleAt4g10360 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38627)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39813
Forward primer (5'-3')
TTGATGACCTGAAGAAACTTGAATGG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
AGTAATAGAAAATCATTGCCAAGTCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200+300
Solanum lycopersicum TA209
275
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26653)
Chromosome
4
Position
6.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g10360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8212 marker 8212
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)