SGN Marker C2_At4g11060

SGN-M8217
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201287---
Lycopersicon CombinedSingleSGN-U235895---
Solanum tuberosumMultipleSGN-U262073---
ArabidopsisSingleAt4g11060 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38628)
Chromosome
1
Position
115.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39814
Forward primer (5'-3')
ACCTCTACGTTGTGCTATTCAACTGGT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGATTGCCCGACTTTGCCACATATAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26658)
Chromosome
4
Position
6.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g11060  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8217 marker 8217
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)