Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g11970

SGN-M8225
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304501 (SGN)
119597 (CGN)
---
Lycopersicon CombinedMultipleSGN-U219018---
Solanum tuberosumSingleSGN-U251890---
ArabidopsisSingleAt4g11970 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38632)
Chromosome
8
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39818
Forward primer (5'-3')
TCAAGTGCAATTGAAAAGGGTAAAC
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAAATACCCACTCATGTTGACACTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26666)
Chromosome
4
Position
7.18 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32448
Forward primer (5'-3')
TCAAGTGCAATTGAAAAGGGTAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAATACCCACTCATGTTGACACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32449
Forward primer (5'-3')
TCAAGTGCAATTGAAAAGGGTAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAATACCCACTCATGTTGACACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32450
Forward primer (5'-3')
TCAAGTGCAATTGAAAAGGGTAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAATACCCACTCATGTTGACACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32451
Forward primer (5'-3')
TCAAGTGCAATTGAAAAGGGTAAAC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 150+320+340
Solanum pennellii LA716: 200+330
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAATACCCACTCATGTTGACACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g11970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8225 marker 8225
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)