SGN Marker SSR150

SGN-M823

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 55
Repeat motif: CTT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ATGCCTCGCTACCTCCTCTT
Reverse primer: AATCGTTCGTTCACAAACCC
Predicted size: 215
Derivations 
This marker was derived from EST read SGN-E150612
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42988)
Chromosome
1
Position
41.70 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43988
Forward primer (5'-3')
ATGCCTCGCTACCTCCTCTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCGTTCGTTCACAAACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39179)
Chromosome
1
Position
115.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14
Forward primer (5'-3')
ATGCCTCGCTACCTCCTCTT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCGTTCGTTCACAAACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 210+216
Solanum lycopersicum LA925: 216+216
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR150 was used as an overgo probe on plate 3 [well A5]

Plausible BAC Matches:   P126B18,   P038D20,   P290K06,   P126A04,   P040L01,   P220A02,   P222E21,   P236F18,   P065N03,   P162O15,   P120A14,   P108M19,   P302G11,   P112A20,   P331D23,   P112O20,   P106B22

 Overgo Sequences

A sequence
ATGGAGTGCTCGTCTATCTTCTGC
B sequence
TTGATAGCGCCTGGAAGCAGAAGA
AB sequence
ATGGAGTGCTCGTCTATCTTCTGCTTCCAG
Marker sequence
GTAAATGCCTCGCTACCTCCTCTTCATCATCTGCTTCTTCTTCTTCTTCT
TCTTATACATCATCTTCATTGATTCGTCGTCGTTTTCTCACACCTAAATC
GCACTCTTCTCTCTTCGTTCGACAAATCACTCACTCTCTCTCTCTTTCTC
TACACCGACACTCCTTACAATTCATAATTTTATCAACTCATCATTCTTAG
GGTTTGTGAACGAACGATTGAGTCGAATTGATACTTGAATTTCACTGTTT
CAAATCAGAAGTTAGATCTTAATCTGTGAGGATTCAAAAGTAAAGTGAAG
CAAATATGGATGCTGATTCATGGAGTGCTCGTCTATCTTCTGCTTCCAGG
CGCTATCAATCTGCTTTTCAGTCTCGATCTGGAATGAAATGGGAGAATCT
TGAGGCGGAAATGTTGATGGGTTTTGAGGAACTAGACGTGGATGATGATA
TAAGAGAAGAGTTCCCTTGCTGCTTTTGTTCAGAGTATTTTGATA
Genomic location of SSR150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D823 marker 823
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)