SGN Marker C2_At4g12590

SGN-M8231
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300841 (SGN)
122923 (CGN)
---
Capsicum annuumSingleSGN-U199571---
Lycopersicon CombinedSingleSGN-U216982---
ArabidopsisSingleAt4g12590 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41470)
Chromosome
5
Position
82.10 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43446
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCAAGCTCTTAATATTGACAAAGAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38635)
Chromosome
5
Position
105.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39820
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150
Solanum pennellii TA56
100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26672)
Chromosome
4
Position
7.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11401
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11402
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11403
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13401
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13402
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13403
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13404
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13405
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13406
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13407
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13408
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13409
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13410
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13411
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13412
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13413
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13414
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33090
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 33091
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 33092
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 33093
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11404
Forward primer (5'-3')
ACATGGCTATGGATATGATGAAGAAG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCAGAGAAGAAGAAGTTGACCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g12590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8231 marker 8231
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)