Sol Genomics Network

SGN Marker C2_At4g14110

SGN-M8242
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	301802 (SGN) 122895 (CGN)	-	-	-
Capsicum annuum	Single	SGN-U197229	-	-	-
Lycopersicon Combined	Single	SGN-U231736	-	-	-
Arabidopsis	Single	At4g14110 on TAIR	-	-	-

Mapped locations

Map: Solanum michoacanum 2011
Map version 155 (location: 109242)
Chromosome 1
Position 90.99 cM
Confidence uncalculated
Protocol CAPS

Solanum michoacanum 2011

Map: Tomato-EXPEN 2000
Map version 52 (location: 38637)
Chromosome 1
Position 136.30 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39822

Forward primer (5'-3')

AGCTCCTTCTTTCCGCTTATTCAAC

Accessions and product sizes

Solanum pennellii TA56

Multiple

Approximate temperature

50°C

Reverse primer (5'-3')

TGGAAGACATATTCAGTCAAGCGCTG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26683)
Chromosome 4
Position 8.13 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32452
Forward primer (5'-3') AGCTCCTTCTTTCCGCTTATTCAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGAAGACATATTCAGTCAAGCGCTG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1100	Approximate temperature 55°C

PCR data Exp. ID 32453
Forward primer (5'-3') AGCTCCTTCTTTCCGCTTATTCAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGAAGACATATTCAGTCAAGCGCTG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1100	Approximate temperature 55°C

PCR data Exp. ID 32454
Forward primer (5'-3') AGCTCCTTCTTTCCGCTTATTCAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGAAGACATATTCAGTCAAGCGCTG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1100	Approximate temperature 55°C

PCR data Exp. ID 32455
Forward primer (5'-3') AGCTCCTTCTTTCCGCTTATTCAAC	Digested band sizes (using RsaI) Solanum pennellii LA716: 700+400 Solanum lycopersicum LA925: 600+400+100	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TGGAAGACATATTCAGTCAAGCGCTG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1100 Solanum lycopersicum LA925: 1100	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g14110

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8242 marker 8242

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer