SGN Marker C2_At4g14570

SGN-M8245
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203914---
Lycopersicon CombinedMultipleSGN-U241181---
Solanum tuberosumSingleSGN-U254095---
ArabidopsisSingleAt4g14570 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46716)
Chromosome
9
Position
16.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38638)
Chromosome
3
Position
4.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39823
Forward primer (5'-3')
AAAGCTTCTTGTAGTTAGAAATCCTGAA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTCCAGCTCCCACAGTCCTTATCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26686)
Chromosome
4
Position
8.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g14570  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8245 marker 8245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)