Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At4g15010

SGN-M8249
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201402---
Lycopersicon CombinedMultipleSGN-U217777---
Solanum tuberosumSingleSGN-U256428---
ArabidopsisSingleAt4g15010 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42238)
Chromosome
11
Position
34.50 cM
Confidence
I(LOD2)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43805
Forward primer (5'-3')
ATAGGTATGCTTCAATTCTTATGCTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGAAAAGATTGTCATCCAAGCATGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41471)
Chromosome
12
Position
40.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43447
Forward primer (5'-3')
ACATCCCAATTTGGTTACTGCCCTG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AGGGGACAATGGACCAACTTCTTCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38639)
Chromosome
11
Position
9.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41560
Forward primer (5'-3')
ACATCCCAATTTGGTTACTGCCCTG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGGACAATGGACCAACTTCTTCATC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
125
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26690)
Chromosome
4
Position
8.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g15010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8249 marker 8249
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)