Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g15420

SGN-M8251
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309339 (SGN)
129137 (CGN)
---
Capsicum annuumSingleSGN-U201957---
Lycopersicon CombinedSingleSGN-U241750---
Solanum tuberosumSingleSGN-U253698---
ArabidopsisSingleAt4g15420 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38640)
Chromosome
7
Position
44.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39824
Forward primer (5'-3')
TCTAATTTAAAGATTGGACAGCAAGC
Accessions and product sizes
Solanum lycopersicum TA209
3000
Approximate temperature
55°C
Reverse primer (5'-3')
TGGTGTATGTCCATATCTTTCAACATAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26692)
Chromosome
4
Position
8.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11405
Forward primer (5'-3')
TCTAATTTAAAGATTGGACAGCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTATGTCCATATCTTTCAACATAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11406
Forward primer (5'-3')
TCTAATTTAAAGATTGGACAGCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTATGTCCATATCTTTCAACATAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11407
Forward primer (5'-3')
TCTAATTTAAAGATTGGACAGCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTATGTCCATATCTTTCAACATAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11408
Forward primer (5'-3')
TCTAATTTAAAGATTGGACAGCAAGC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 190+380
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTATGTCCATATCTTTCAACATAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
All possible enzymes for lycopersicum and pimpinellifolium: UbaTI
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g15420F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g15420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8251 marker 8251
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)