SGN Marker C2_At4g15545

SGN-M8254
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303287 (SGN)
120870 (CGN)
---
Solanum tuberosumSingleSGN-U258761---
ArabidopsisSingleAt4g15545 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26696)
Chromosome
4
Position
8.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41561
Forward primer (5'-3')
AGCGAATTCGATCTTCCCGAGG
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAGGTCTTGAAGCTGGCAAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
250+1050
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g15545  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8254 marker 8254
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)