Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At4g16710

SGN-M8275
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307022 (SGN)
131502 (CGN)
---
Lycopersicon CombinedSingleSGN-U224257---
Solanum tuberosumSingleSGN-U251307---
ArabidopsisSingleAt4g16710 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41473)
Chromosome
9
Position
126.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43449
Forward primer (5'-3')
AGTTTTTGTGACCGTGGGGACAAC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TGAACCTGCGTGGCTGATAACAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38648)
Chromosome
12
Position
40.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39830
Forward primer (5'-3')
AGTTTTTGTGACCGTGGGGACAAC
Accessions and product sizes
Solanum lycopersicum TA209
1650
Solanum pennellii TA56
1650
Approximate temperature
55°C
Reverse primer (5'-3')
TGAACCTGCGTGGCTGATAACAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26716)
Chromosome
4
Position
9.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11417
Forward primer (5'-3')
AGTTTTTGTGACCGTGGGGACAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACCTGCGTGGCTGATAACAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11418
Forward primer (5'-3')
AGTTTTTGTGACCGTGGGGACAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACCTGCGTGGCTGATAACAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11419
Forward primer (5'-3')
AGTTTTTGTGACCGTGGGGACAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACCTGCGTGGCTGATAACAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g16710F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g16710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8275 marker 8275
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)