Sol Genomics Network

SGN Marker C2_At4g17380

SGN-M8283
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	307088 (SGN) 127795 (CGN)	-	-	-
Solanum tuberosum	Single	SGN-U255268	-	-	-
Arabidopsis	Single	At4g17380 on TAIR	-	-	-

Mapped locations

Map: Pepper-COSII
Map version 58 (location: 41474)
Chromosome 8
Position 25.60 cM
Confidence F(LOD3)
Protocol dCAPS

Pepper-COSII

PCR data Exp. ID 43450

Forward primer (5'-3')

CTTCAACTTGCAAATGTTCTCTTAATA

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AATTGCCAATAGATGCTCACAACAG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38650)
Chromosome 8
Position 2.00 cM
Confidence CF(LOD3)
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39832

Forward primer (5'-3')

TGGTCATCCTTGCTCAAATTGGTTG

Accessions and product sizes

Solanum pennellii TA56

Multiple

Approximate temperature

50°C

Reverse primer (5'-3')

AATTGCCAATAGATGCTCACAACAG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26724)
Chromosome 4
Position 9.71 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32464
Forward primer (5'-3') TGGTCATCCTTGCTCAAATTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AATTGCCAATAGATGCTCACAACAG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 600	Approximate temperature 55°C

PCR data Exp. ID 32465
Forward primer (5'-3') TGGTCATCCTTGCTCAAATTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AATTGCCAATAGATGCTCACAACAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 600	Approximate temperature 55°C

PCR data Exp. ID 32466
Forward primer (5'-3') TGGTCATCCTTGCTCAAATTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AATTGCCAATAGATGCTCACAACAG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 600	Approximate temperature 55°C

PCR data Exp. ID 32467
Forward primer (5'-3') TGGTCATCCTTGCTCAAATTGGTTG	Digested band sizes (using HinfI) Solanum lycopersicum LA925: 475 Solanum pennellii LA716: 275+200	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AATTGCCAATAGATGCTCACAACAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 600 Solanum pennellii LA716: 600	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g17380

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8283 marker 8283

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer