Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At4g17620

SGN-M8285
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309940 (SGN)
129310 (CGN)
---
Lycopersicon CombinedSingleSGN-U221146---
ArabidopsisSingleAt4g17620 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38651)
Chromosome
8
Position
55.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39833
Forward primer (5'-3')
TCCGCGACCGGGACCTTATCC
Accessions and product sizes
Solanum lycopersicum TA209
1600
Solanum pennellii TA56
1600
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTCAGGTCTGCCCCAACATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
550+1050
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26726)
Chromosome
4
Position
9.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32468
Forward primer (5'-3')
TCCGCGACCGGGACCTTATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGGTCTGCCCCAACATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
60°C
  
PCR data   Exp. ID 32469
Forward primer (5'-3')
TCCGCGACCGGGACCTTATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGGTCTGCCCCAACATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
60°C
  
PCR data   Exp. ID 32470
Forward primer (5'-3')
TCCGCGACCGGGACCTTATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGGTCTGCCCCAACATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
60°C
  
PCR data   Exp. ID 32471
Forward primer (5'-3')
TCCGCGACCGGGACCTTATCC
Digested band sizes (using DraI)
Solanum pennellii LA716: 175+225+475
Solanum lycopersicum LA925: 175+225+250+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGGTCTGCCCCAACATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 900
Approximate temperature
60°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g17620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8285 marker 8285
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)