SGN Marker C2_At4g18060

SGN-M8287
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205127---
Solanum tuberosumSingleSGN-U251812---
ArabidopsisSingleAt4g18060 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46719)
Chromosome
2
Position
4.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41475)
Chromosome
2
Position
63.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43451
Forward primer (5'-3')
TCAAGCAGTTTAGTGCAACTGGTTATG
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
TGCCTTAACAATCTCTTTCTGAAAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38652)
Chromosome
2
Position
45.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41572
Forward primer (5'-3')
TCAAGCAGTTTAGTGCAACTGGTTATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCCTTAACAATCTCTTTCTGAAAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26728)
Chromosome
4
Position
10.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g18060  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8287 marker 8287
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)