SGN Marker C2_At4g18260

SGN-M8289
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200512---
Lycopersicon CombinedSingleSGN-U221182---
Solanum tuberosumSingleSGN-U252645---
ArabidopsisSingleAt4g18260 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38654)
Chromosome
2
Position
41.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41574
Forward primer (5'-3')
ACAAGCTTGAGATGAAAGCAATCAAGG
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTTGACTTGCTTCTTTATGAACTTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26730)
Chromosome
4
Position
10.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g18260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8289 marker 8289
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)