SGN Marker C2_At4g18810

SGN-M8295
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306985 (SGN)
127128 (CGN)
---
Capsicum annuumSingleSGN-U205193---
ArabidopsisSingleAt4g18810 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38656)
Chromosome
2
Position
48.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39835
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26736)
Chromosome
4
Position
10.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11424
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11425
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11426
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13424
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13425
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13426
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13427
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13428
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13429
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13430
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13431
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13432
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13433
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32642
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33098
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33099
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33100
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11427
Forward primer (5'-3')
TTCGATCAAGGCGACAATATCACG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 280
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCAATTTCTTCACTGGATATTTTTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, RsaI. DraI, KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g18810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8295 marker 8295
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)