SGN Marker TG60

SGN-M83

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3200
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAAGACTCTCACTGTTGGGGCCGTCTAGGTTTGTGGTAGGTTCATCCAGTGCTAGAATTCCGCAGTTGAGACAAAAAGTTTCAGCCAACG
CCAATCGTATGATGAGTGATGCAAGGACCTGAAGAATAACAAAACTCCGGTAAAAAACCAGTTCAAAAGAAAAGAAGAAAAAAAAACTCA
AGTTCAGTGAAAGTTCTGTTGGGGTTCGGATTTTTTCTTTTTCCTCCATTTTATTTGAAGAGAAGGTGGGGCTGAGAGGAAGCTAAGCAA
AAGGAGAGTTCAAACCAAAGCTTTATTGGCATATAAATTAAGTGAACACGATAAAGAAAAAATAAAAATTGAGATGACTGATCACCTTTT
GGCCAGCACTACACCTCCCTCGCATTTCTAGTTCAGTATCACCAGTCAACATCACAACCTGTGAATCACAAGCATTATTATAAAAGTGCG
GAAACTATCAACAAATGTTCATGGGCTTTTACTGCAAAGTGCACATTTCACAAAGAAAAAGA
Reverse sequence
GAAGCCTGTCAGAATCTCAACTCCAAAGTTGCGAGTCCAGAAAGGATGCGATTTTGGCTGAAGTGAAGAAAAGTAAGGATTTAATGGGGA
ACCAGGATAGGTTGAGACGTAACATTGAGGATAACTTGAACTATCGTAAAATTAAGTCTGAAGTTGATGAGCTCACTCATGAGATTGAAT
TACTGGAAGATAAAGTGCTGACGTTGGGTGGGTTTTCTTCTGTTGAAGCTGAGCTTAAAAAGCTTTCACACGAAAGAGAGAGGCTACTCT
CTGAGGTAAGAATCTATATCTATATGAATATGTTGGGCAATTACTTTTGGTATAAATATCCAACCTATGAAATCATGTGCTAGCTTTTGA
CTCTTGATGAACGTGATTAAGATTGTAGAACTTTTCTCTTCTGGATTCCATATGATTTCAGTAAAGATCGCCATATGCGCAAGCTTAACC
ATGATGGAAAGTTCAATTCAAGAGGCCAATAATATGGTCTGGTTTACTTTTCCAGCTAGAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1489437.9e-3167 (13.1% of RFLP seq)+
SGN-U1489431.9e-62120 (23.4% of RFLP seq)+
SGN-U1489436e-155275 (53.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53363)
Chromosome
5
Position
45.26 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40890)
Chromosome
5
Position
85.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36590
Forward primer (5'-3')
GGGCTTTTACTGCAAAGTGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGTTGCGAGTCCAGAAAGGA
Digested band sizes (using PvuII)
Solanum lycopersicum TA209
3000
Solanum pennellii TA56
2400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40108)
Chromosome
5
Position
104.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8008)
Chromosome
5
Position
106.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8009)
Chromosome
5
Position
75.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8013)
Chromosome
5
Position
41.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG60 was used as an overgo probe on plate 5 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAACGCCAATCGTATGATGAGTG
B sequence
CTTCAGGTCCTTGCATCACTCATC
AB sequence
CCAACGCCAATCGTATGATGAGTGATGCAA
Marker sequence
CAAGACTCTCACTGTTGGGGCCGTCTAGGTTTGTGGTAGGTTCATCCAGT
GCTAGAATTCCGCAGTTGAGACAAAAAGTTTCAGCCAACGCCAATCGTAT
GATGAGTGATGCAAGGACCTGAAGAATAACAAAACTCCGGTAAAAAACCA
GTTCAAAAGAAAAGAAGAAAAAAAAACTCAAGTTCAGTGAAAGTTCTGTT
GGGGTTCGGATTTTTTCTTTTTCCTCCATTTTATTTGAAGAGAAGGTGGG
GCTGAGAGGAAGCTAAGCAAAAGGAGAGTTCAAACCAAAGCTTTATTGGC
ATATAAATTAAGTGAACACGATAAAGAAAAAATAAAAATTGAGATGACTG
ATCACCTTTTGGCCAGCACTACACCTCCCTCGCATTTCTAGTTCAGTATC
ACCAGTCAACATCACAACCTGTGAATCACAAGCATTATTATAAAAGTGCG
GAAACTATCAACAAATGTTCATGGGCTTTTACTGCAAAGTGCACATTTCA
CAAAGAAAAAGA
Genomic location of TG60  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D83 marker 83
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)