SGN Marker C2_At4g20070

SGN-M8303
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309271 (SGN)
127819 (CGN)
---
Lycopersicon CombinedMultipleSGN-U219155---
Solanum tuberosumSingleSGN-U253010---
ArabidopsisSingleAt4g20070 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46721)
Chromosome
2
Position
1.80 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46505)
Chromosome
2
Position
48.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38659)
Chromosome
2
Position
29.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39837
Forward primer (5'-3')
ACCTAGAGAGGACCTTCCAGAGCCC
Accessions and product sizes
Solanum lycopersicum TA209
Multiple
Solanum pennellii TA56
Multiple
Approximate temperature
60°C
Reverse primer (5'-3')
AGGAATTCAGTGCCTTCAATGCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26744)
Chromosome
4
Position
10.86 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32476
Forward primer (5'-3')
ACCTAGAGAGGACCTTCCAGAGCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAATTCAGTGCCTTCAATGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
60°C
  
PCR data   Exp. ID 32477
Forward primer (5'-3')
ACCTAGAGAGGACCTTCCAGAGCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAATTCAGTGCCTTCAATGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
60°C
  
PCR data   Exp. ID 32478
Forward primer (5'-3')
ACCTAGAGAGGACCTTCCAGAGCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAATTCAGTGCCTTCAATGCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
60°C
  
PCR data   Exp. ID 32479
Forward primer (5'-3')
ACCTAGAGAGGACCTTCCAGAGCCC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAATTCAGTGCCTTCAATGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
60°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g20070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8303 marker 8303
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)