SGN Marker C2_At4g20410

SGN-M8307
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301221 (SGN)
122421 (CGN)
---
Lycopersicon CombinedSingleSGN-U222292---
Solanum tuberosumSingleSGN-U245717---
ArabidopsisSingleAt4g20410 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41479)
Chromosome
2
Position
47.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43455
Forward primer (5'-3')
GCTTATCTTAGTGCAATCATTGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCGTCAGCATATGCAGAAAGAAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38660)
Chromosome
2
Position
36.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39838
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26747)
Chromosome
4
Position
11.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11434
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11435
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11436
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13434
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13435
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 600+680
Approximate temperature
55°C
  
PCR data   Exp. ID 13436
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13437
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13438
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32643
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33101
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33102
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11437
Forward primer (5'-3')
TGTGGGAGGCCCCAACCTGC
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 500+850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGGTGCTCCATCTTCTAAAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, EcoRV
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g20410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8307 marker 8307
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)