SGN Marker C2_At4g20850

SGN-M8308
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304271 (SGN)
121676 (CGN)
---
Capsicum annuumSingleSGN-U197551---
Lycopersicon CombinedSingleSGN-U217196---
ArabidopsisSingleAt4g20850 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26748)
Chromosome
4
Position
11.17 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41578
Forward primer (5'-3')
TCTTTCTAGCTTGAATCAAGGCACAG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCACGCCTTCCAGTATTTTAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11438
Forward primer (5'-3')
TCTTTCTAGCTTGAATCAAGGCACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCACGCCTTCCAGTATTTTAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750+1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11439
Forward primer (5'-3')
TCTTTCTAGCTTGAATCAAGGCACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCACGCCTTCCAGTATTTTAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11440
Forward primer (5'-3')
TCTTTCTAGCTTGAATCAAGGCACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCACGCCTTCCAGTATTTTAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g20850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8308 marker 8308
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)