SGN Marker C2_At4g21120

SGN-M8312
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303604 (SGN)
123539 (CGN)
---
Solanum tuberosumSingleSGN-U261955---
ArabidopsisSingleAt4g21120 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46722)
Chromosome
2
Position
4.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38661)
Chromosome
2
Position
40.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39839
Forward primer (5'-3')
TATAAGAGCATTGATCCTAATGCTCC
Accessions and product sizes
Solanum lycopersicum TA209
550
Solanum pennellii TA56
550
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCTTTGGATTACGAGCCTGAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200+350
Solanum lycopersicum TA209
150+200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26752)
Chromosome
4
Position
11.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g21120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8312 marker 8312
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)