SGN Marker C2_At4g21710

SGN-M8321
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301836 (SGN)
124659 (CGN)
---
Lycopersicon CombinedSingleSGN-U226065---
Solanum tuberosumSingleSGN-U258227---
ArabidopsisSingleAt4g21710 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49274)
Chromosome
2
Position
37.59 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47213)
Chromosome
2
Position
69.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46723)
Chromosome
2
Position
6.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41480)
Chromosome
2
Position
70.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43456
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38665)
Chromosome
2
Position
63.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39843
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
Accessions and product sizes
Solanum pennellii TA56
Multiple
Approximate temperature
50°C
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26761)
Chromosome
4
Position
11.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32484
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32485
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32486
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32487
Forward primer (5'-3')
TGACGGGCTCAGATTTGTTAAAGTG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 175+275
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGTCATCAACCATATGCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g21710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8321 marker 8321
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)