SGN Marker C2_At4g22930

SGN-M8334
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U220123---
Solanum tuberosumSingleSGN-U257101---
ArabidopsisSingleAt4g22930 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26775)
Chromosome
4
Position
12.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41585
Forward primer (5'-3')
TCATGGAGAGGTTACTAATCCTGAGG
Accessions and product sizes
Solanum pennellii TA56
470
Solanum lycopersicum TA209
470
Approximate temperature
55°C
Reverse primer (5'-3')
AGGACTGGAAGGCAGTAATTATGCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
470
Solanum pennellii TA56
420
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11468
Forward primer (5'-3')
TCATGGAGAGGTTACTAATCCTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACTGGAAGGCAGTAATTATGCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 370
Approximate temperature
55°C
  
PCR data   Exp. ID 11469
Forward primer (5'-3')
TCATGGAGAGGTTACTAATCCTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACTGGAAGGCAGTAATTATGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 370
Approximate temperature
55°C
  
PCR data   Exp. ID 11470
Forward primer (5'-3')
TCATGGAGAGGTTACTAATCCTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACTGGAAGGCAGTAATTATGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 370
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g22930F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g22930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8334 marker 8334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)