SGN Marker C2_At4g23840

SGN-M8338
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310018 (SGN)
129020 (CGN)
---
Solanum tuberosumSingleSGN-U261962---
ArabidopsisSingleAt4g23840 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46724)
Chromosome
8
Position
77.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42242)
Chromosome
8
Position
114.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43809
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41482)
Chromosome
1
Position
19.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43458
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
Accessions and product sizes
Approximate temperature
65°C
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38671)
Chromosome
8
Position
82.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39848
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
900
Approximate temperature
60°C
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
175+225+250+300
Solanum pennellii TA56
175+225+475
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26779)
Chromosome
4
Position
12.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32492
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32493
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32494
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32495
Forward primer (5'-3')
AGGGGAGAGAGTTATGTGGATGCAG
Digested band sizes (using ApoI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCATCAGCTGTGACACCTGTTTCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g23840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8338 marker 8338
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)