Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g26680

SGN-M8373
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301367 (SGN)
121631 (CGN)
---
Lycopersicon CombinedSingleSGN-U229363---
ArabidopsisSingleAt4g26680 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46508)
Chromosome
7
Position
4.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41484)
Chromosome
7
Position
55.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43460
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38678)
Chromosome
7
Position
38.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39855
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
175+275
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26814)
Chromosome
4
Position
13.46 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32500
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32501
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32502
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32503
Forward primer (5'-3')
TGCAAATCGGGAAAACTAGAAAAGG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGTCCCATAATCAATGCATTGTAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g26680  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8373 marker 8373
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)