Sol Genomics Network

SGN-M8382
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Lycopersicon Combined	Single	SGN-U218461	-	-	-
Solanum tuberosum	Single	SGN-U246558	-	-	-
Arabidopsis	Single	At4g27700 on TAIR	-	-	-

Map: Tomato - Kazusa and SolCAP markers mapped to genome
Map version 105 (location: 49276)
Chromosome 6
Position 32.36 MB
Confidence uncalculated
Protocol CAPS

Tomato - Kazusa and SolCAP markers mapped to genome

Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46727)
Chromosome 6
Position 25.00 cM
Confidence I(LOD2)
Protocol CAPS

Tobacco N. tomentosiformis

Tomato-EXPEN 2000

PCR data Exp. ID 39857

Forward primer (5'-3')

AGCTACTAAACCTGCTAAATCACC

Accessions and product sizes

Solanum pennellii TA56

1500

Solanum lycopersicum TA209

1500

Approximate temperature

55°C

Reverse primer (5'-3')

TCGGCTTCAGGTCGTACATCAAG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 11505
Forward primer (5'-3') AGCTACTAAACCTGCTAAATCACC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCGGCTTCAGGTCGTACATCAAG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 500	Approximate temperature 55°C

PCR data Exp. ID 11506
Forward primer (5'-3') AGCTACTAAACCTGCTAAATCACC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCGGCTTCAGGTCGTACATCAAG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 500	Approximate temperature 55°C

PCR data Exp. ID 11507
Forward primer (5'-3') AGCTACTAAACCTGCTAAATCACC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCGGCTTCAGGTCGTACATCAAG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 500	Approximate temperature 55°C

PCR data Exp. ID 11508
Forward primer (5'-3') AGCTACTAAACCTGCTAAATCACC	Digested band sizes (using RsaI) Solanum pennellii LA716: 500 Solanum lycopersicum LA925: 400	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCGGCTTCAGGTCGTACATCAAG	Enzymes All possible enzymes for pennellii and and lycopersicum: ApoI,AseI,BglI,HinfI,RsaI,SsPI,StyI,TspRI All possible enzymes for lycopersicum and pimpinellifolium: Hpy8I/MjaIV,HpyCH4V
Accessions and product sizes Solanum lycopersicum LA925: 500 Solanum pennellii LA716: 500	Approximate temperature 55°C