SGN Marker C2_At4g28530

SGN-M8392
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306803 (SGN)
126728 (CGN)
---
Lycopersicon CombinedSingleSGN-U240829---
ArabidopsisSingleAt4g28530 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49277)
Chromosome
6
Position
45.44 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47216)
Chromosome
6
Position
107.87 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46728)
Chromosome
6
Position
89.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41486)
Chromosome
6
Position
135.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43462
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38682)
Chromosome
6
Position
98.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39859
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
Accessions and product sizes
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
900
Approximate temperature
58°C
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26833)
Chromosome
4
Position
14.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32506
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32507
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32508
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32509
Forward primer (5'-3')
TGGAAATTGATCTTCACACTTGTGAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 250+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAGTCGAAATTCATGCATGATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g28530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8392 marker 8392
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)