SGN Marker TG581

SGN-M84

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG581 image not available
Forward sequence
CTTGTTAGTTGCTGTTGTTACTTAATCATCAGCATTTCCAATAAATGATGTATTGCTTGGTAATACTGTACTGTGAAACTGTAAAATTTA
AGAGAGAAATGGAGTGAATACAGTGAAAATGCAGAGACTCTACATTCAGACAAAGTGGTCTTTAAAACATGGCGCAAAATGAAATAAGCT
GAGAATTTCTAATTTTCTTCAATGAGATAATTATTGTTGGAACTTCTATCAATACGTTAATCTGTAGCTCTATCAAACTGGCAGTGCCTA
GGAACCCAGACTTTAGCCTGGACGTTGAACGGATTACCGAAGTGGTTGAACGTGAGAAACCAAAGTGCATATTTCTGACATCACCTAATA
ATCCTGATGGGAGGTATTGCTACATTGTATTCTTTGTCTATTTCTCATTGTGGTTGTACTTTGCTCCCCTTGATTGTACTGCATGTGAGA
GTTTCTCTACCCCCAATCCCACCTGTC
Reverse sequence
CATGGAATCTACATCATTTATAATGGCCATGTTGCACCAAAAAATCTAGCAAAGAAATACAATTTTGTTTAAGATTATGCATGTTGCAAT
GTTTGTCTTCAAAAAATCAGTATGTTTCTTTCCATCCATATTGTCCACCAAACGATTATGGGAATAGTATCGCGACCATCTCATCATTGG
TGTTCTCCTCCAATTAAAAAAGAAACACAGTATTACTGGCTAAATTGAGATTCTAGTAATACTTTCCTATTAGTCATTTTCTCCATCTCA
CGAACCTAGAAAATAGTGAAAAAAATGAAAAAAGGAAAGCTGCAACTGAAAGCTTTGAAGATGATTGGAACTAAGACAGGTGGGATTGGG
GGTAGAGAAACTCTCACATGCAGTACAATCAAGGGGAGCAAAGTACAACCACAATGAGAAATAGACAAAGAATACAATGTAGCAATACCT
CCCATCAGGATTATTAGGTGATGTCAGAAATATGCACTTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1476541.6e-56110 (23.1% of RFLP seq)+
SGN-U1476541.6e-1643 (8.8% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53360)
Chromosome
12
Position
35.88 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40098)
Chromosome
6
Position
96.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8014)
Chromosome
6
Position
89.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG581 was used as an overgo probe on plate 3 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGACTTTAGCCTGGACGTTGAAC
B sequence
ACCACTTCGGTAATCCGTTCAACG
AB sequence
CAGACTTTAGCCTGGACGTTGAACGGATTA
Marker sequence
CTTGTTAGTTGCTGTTGTTACTTAATCATCAGCATTTCCAATAAATGATG
TATTGCTTGGTAATACTGTACTGTGAAACTGTAAAATTTAAGAGAGAAAT
GGAGTGAATACAGTGAAAATGCAGAGACTCTACATTCAGACAAAGTGGTC
TTTAAAACATGGCGCAAAATGAAATAAGCTGAGAATTTCTAATTTTCTTC
AATGAGATAATTATTGTTGGAACTTCTATCAATACGTTAATCTGTAGCTC
TATCAAACTGGCAGTGCCTAGGAACCCAGACTTTAGCCTGGACGTTGAAC
GGATTACCGAAGTGGTTGAACGTGAGAAACCAAAGTGCATATTTCTGACA
TCACCTAATAATCCTGATGGGAGGTATTGCTACATTGTATTCTTTGTCTA
TTTCTCATTGTGGTTGTACTTTGCTCCCCTTGATTGTACTGCATGTGAGA
GTTTCTCTACCCCCAATCCCACCTGTC
Genomic location of TG581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D84 marker 84
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)