Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At4g30580

SGN-M8408
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300974 (SGN)
121506 (CGN)
---
Lycopersicon CombinedSingleSGN-U229764---
Solanum tuberosumSingleSGN-U255822---
ArabidopsisSingleAt4g30580 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49279)
Chromosome
7
Position
0.46 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47218)
Chromosome
7
Position
3.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42245)
Chromosome
7
Position
24.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43812
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41489)
Chromosome
7
Position
13.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43465
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38688)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39864
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26850)
Chromosome
4
Position
14.93 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32511
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32512
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32513
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32514
Forward primer (5'-3')
TCAGCCGGTGCTGCTTATCCAC
Digested band sizes (using CfoI)
Solanum pennellii LA716: 425
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAACTTGAAGTTTCTCCCAAGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g30580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8408 marker 8408
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)