SGN Marker C2_At4g30890

SGN-M8412
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306881 (SGN)
126812 (CGN)
---
Solanum tuberosumSingleSGN-U247720---
ArabidopsisSingleAt4g30890 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46730)
Chromosome
1
Position
59.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38689)
Chromosome
1
Position
40.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39865
Forward primer (5'-3')
ATGCTGATTTTACACCTGAAGCGG
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAGTAACAGAGGCATCATCAAACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
125+200
Solanum pennellii TA56
125+250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26854)
Chromosome
4
Position
15.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32515
Forward primer (5'-3')
ATGCTGATTTTACACCTGAAGCGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAACAGAGGCATCATCAAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32516
Forward primer (5'-3')
ATGCTGATTTTACACCTGAAGCGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAACAGAGGCATCATCAAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32517
Forward primer (5'-3')
ATGCTGATTTTACACCTGAAGCGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAACAGAGGCATCATCAAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32518
Forward primer (5'-3')
ATGCTGATTTTACACCTGAAGCGG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 200+300
Solanum pennellii LA716: 200+350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAACAGAGGCATCATCAAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g30890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8412 marker 8412
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)