SGN Marker C2_At4g31150

SGN-M8417
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203617---
Lycopersicon CombinedMultipleSGN-U222772---
Solanum tuberosumSingleSGN-U262240---
ArabidopsisSingleAt4g31150 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46512)
Chromosome
12
Position
44.60 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41491)
Chromosome
12
Position
99.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43467
Forward primer (5'-3')
TACTGAAGATGACTTCAAATGGAGATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCATTTTATCCAAAAGTTCCAGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38694)
Chromosome
12
Position
96.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39870
Forward primer (5'-3')
TACTGAAGATGACTTCAAATGGAGATT
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
60°C
Reverse primer (5'-3')
TCATTTTATCCAAAAGTTCCAGAA
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26861)
Chromosome
4
Position
15.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g31150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8417 marker 8417
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)