SGN Marker C2_At4g32180

SGN-M8431
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300404 (SGN)
121469 (CGN)
---
Lycopersicon CombinedSingleSGN-U221448---
ArabidopsisSingleAt4g32180 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26875)
Chromosome
4
Position
15.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41615
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
53°C
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11533
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11534
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11535
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13510
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13511
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13512
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13513
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13514
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13515
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13516
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13517
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 500+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13518
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13519
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 800+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13520
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13521
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 33126
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33127
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33128
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33129
Forward primer (5'-3')
TGCGCATGATTTCATATAATATTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGTCCAAAACGCAGTGCATTGAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g32180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8431 marker 8431
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)