SGN Marker C2_At4g32770

SGN-M8443
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302429 (SGN)
119876 (CGN)
---
Lycopersicon CombinedSingleSGN-U230753---
Solanum tuberosumSingleSGN-U265491---
ArabidopsisSingleAt4g32770 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109243)
Chromosome
8
Position
55.74 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49280)
Chromosome
8
Position
54.92 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47220)
Chromosome
8
Position
44.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46732)
Chromosome
8
Position
34.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46514)
Chromosome
8
Position
53.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38699)
Chromosome
8
Position
34.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39873
Forward primer (5'-3')
TCTTCTATGAATTTGTTCCATGGAATG
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
ACCATGGTCCTCCCCCAACTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26886)
Chromosome
4
Position
15.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g32770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8443 marker 8443
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)