SGN Marker C2_At4g33360

SGN-M8452
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309050 (SGN)
131996 (CGN)
---
Capsicum annuumSingleSGN-U203162---
Solanum tuberosumSingleSGN-U261597---
ArabidopsisSingleAt4g33360 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46515)
Chromosome
12
Position
37.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41494)
Chromosome
12
Position
79.00 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43470
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38705)
Chromosome
12
Position
85.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39877
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26895)
Chromosome
4
Position
16.07 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32531
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32532
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 875
Approximate temperature
55°C
  
PCR data   Exp. ID 32533
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 875
Approximate temperature
55°C
  
PCR data   Exp. ID 32534
Forward primer (5'-3')
TGCCAAATAATTTTTCATGCTGCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 875
Solanum pennellii LA716: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACACATTCTTCAAGCCTCCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 875
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g33360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8452 marker 8452
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)